Elsewhere on the internet...

The League of Reason has some social media accounts! You can find us on Facebook or on Twitter for some interesting links and things.

Challenging Christian Hillbilly on evolution.

Post new topic Reply to topic  Page 2 of 3
 [ 41 posts ] 
Challenging Christian Hillbilly on evolution.
Author Message
he_who_is_nobodyBloggerUser avatarPosts: 3318Joined: Tue Feb 24, 2009 1:36 amLocation: Albuquerque, New Mexico Gender: Male

Post Re: Challenging Christian Hillbilly on evolution.

I have not read this paper yet (busy), but if I could venture a guess it has to do with closely related taxa and incomplete lineage sorting. Look up incomplete lineage sorting by Isotalus or Rumraket on this forum to learn more.
_BONES AND FOSSILS = LOVE_
(_'--------------------'_)
(_.--------------------._)
Sun Aug 07, 2016 11:26 pm
YIM WWW
RumraketUser avatarPosts: 1170Joined: Fri Jun 25, 2010 7:49 am Gender: Male

Post Re: Challenging Christian Hillbilly on evolution.

he_who_is_nobody wrote:I have not read this paper yet (busy), but if I could venture a guess it has to do with closely related taxa and incomplete lineage sorting. Look up incomplete lineage sorting by Isotalus or Rumraket on this forum to learn more.

Yes, not only that. It's really just a basic problem in phylogenetics for closely related species. The genes in question have not had enough time to accumulate mutations to make the interrelationships of the included taxa highly accurate. In other words, there is not enough data to work with, to accurately resolve the relationships between these taxa when they are very closely related. Their genomes are, with respect to the statistics used to infer where they sit in the trees, practically identical, and as such do not give enough phylogenetic information to make the trees very accurate.

This leads to question like "Is rabbit species A more closely related to rabbit species B, or to rabbit species C?". Notice how this is different from saying rabbits aren't mammals, or that mammals don't all share common decent (and thus, doesn't have a common ancestor). Which is obviously false, they ARE mammals and they DO share common descent, it's just that (to make an analogy), it's not known very exactly whether they are siblings or cousins, and who is "oldest".

Rhed is simply totally outside his area of understanding. He's apparently "read" a paper he didn't know what was about, if he even read it at all.

Rhed should read 29+ Evidences for Macroevolution: The Scientific Case for Common Descent

Particularly the section "Prediction 1.3: Consilience of independent phylogenies", where it is shown that you EXPECT incongruent trees for closely related species and that despite this, the confirmation of common descent even from incongruent phylogenies is still overwhelmingly well supported by the data:

So, how well do phylogenetic trees from morphological studies match the trees made from independent molecular studies? There are over 1038 different possible ways to arrange the 30 major taxa represented in Figure 1 into a phylogenetic tree (see Table 1.3.1; Felsenstein 1982; Li 1997, p. 102). In spite of these odds, the relationships given in Figure 1, as determined from morphological characters, are completely congruent with the relationships determined independently from cytochrome c molecular studies (for consensus phylogenies from pre-molecular studies see Carter 1954, Figure 1, p. 13; Dodson 1960, Figures 43, p. 125, and Figure 50, p. 150; Osborn 1918, Figure 42, p. 161; Haeckel 1898, p. 55; Gregory 1951, Fig. opposite title page; for phylogenies from the early cytochrome c studies see McLaughlin and Dayhoff 1973; Dickerson and Timkovich 1975, pp. 438-439). Speaking quantitatively, independent morphological and molecular measurements such as these have determined the standard phylogenetic tree, as shown in Figure 1, to better than 38 decimal places. This phenomenal corroboration of universal common descent is referred to as the "twin nested hierarchy". This term is something of a misnomer, however, since there are in reality multiple nested hierarchies, independently determined from many sources of data.

When two independently determined trees mismatch by some branches, they are called "incongruent". In general, phylogenetic trees may be very incongruent and still match with an extremely high degree of statistical significance (Hendy et al. 1984; Penny et al. 1982; Penny and Hendy 1986; Steel and Penny 1993). Even for a phylogeny with a small number of organisms, the total number of possible trees is extremely large. For example, there are about a thousand different possible phylogenies for only six organisms; for nine organisms, there are millions of possible phylogenies; for 12 organisms, there are nearly 14 trillion different possible phylogenies (Table 1.3.1; Felsenstein 1982; Li 1997, p. 102). Thus, the probability of finding two similar trees by chance via two independent methods is extremely small in most cases. In fact, two different trees of 16 organisms that mismatch by as many as 10 branches still match with high statistical significance (Hendy et al. 1984, Table 4; Steel and Penny 1993). For more information on the statistical significance of trees that do not match exactly, see "Statistics of Incongruent Phylogenetic Trees".

The stunning degree of match between even the most incongruent phylogenetic trees found in the biological literature is widely unappreciated, mainly because most people (including many biologists) are unaware of the mathematics involved (Bryant et al. 2002; Penny et al. 1982; Penny and Hendy 1986). Penny and Hendy have performed a series of detailed statistical analyses of the significance of incongruent phylogenetic trees, and here is their conclusion:

"Biologists seem to seek the 'The One Tree' and appear not to be satisfied by a range of options. However, there is no logical difficulty in having a range of trees. There are 34,459,425 possible [unrooted] trees for 11 taxa (Penny et al. 1982), and to reduce this to the order of 10-50 trees is analogous to an accuracy of measurement of approximately one part in 106." (Penny and Hendy 1986, p. 414)
"Nullius in verba" - Take nobody's word for it. https://en.wikipedia.org/wiki/Nullius_in_verba
Extraordinary claims require extraordinary evidence.
Mon Aug 08, 2016 1:09 pm
WarKChat ModeratorUser avatarPosts: 1182Joined: Wed Aug 12, 2009 9:59 am Gender: Tree

Post Re: Challenging Christian Hillbilly on evolution.

Thank You Rumraket.

My guess is that Rhed noticed word discordance in the title of the paper and assumed it meant evolution was wrong and thus creationism correct by default.
Did you see that ludicrous display last night?
Mon Aug 08, 2016 2:27 pm
Nesslig20User avatarPosts: 259Joined: Wed Mar 16, 2016 6:44 pm Gender: Male

Post Re: Challenging Christian Hillbilly on evolution.

Rhed wrote:I see, you are asking from a Creation point of view. While new evidence is always changing and updating the Tree of Life or the Orchard of Life, I would say, for example, there is the horse kind, rhino kind, and bear kind. Each kind has a common ancestor, but the horse, rhino, and bear do not share a common ancestor as even going further back to the eukaryotic cell shown in the Tree of Life.


But how did you identify those "kinds"? I gave you the examples of Cats and their relatives (here) but how far does this relatedness go, when does it stop? And more importantly, how do you KNOW when relatedness stops.

And if Horses and Rhinos are "kinds", then why do Rhinos and Tapirs belong together under Ceratomorpha? Are Rhinos and Tapirs the same kind? And why do both Rhinos and Tapirs belong together with Horses under Perissodactyla? Are they the same kind? Why or why not?

If they are separate, what about their extinct relatives (or apparent relatives)?
Like
Image
Hyracotherium (Eohippus) A distant relative of the "horse-kind"?

And
Image
Hyrachyus, A distant relative of the "Rhino-Kind"?

Wait, hold on. Aren't these two above very similar even though they belong to separate kinds?

And what about bears?
Image
Is this the "Bear-kind"?
And Ursavus
Image
the common ancestor of all extant bears?
And what about extinct Ursids, like the small-sized, dog-like Cephalogale
Image
This animal, along with others like it, are Hemicyonids, also known as "Dog-Bears"
Not to be confused with Amphicyonids - "Bear-Dogs" like Cynodictis
Image
The progenitor of both dogs and bears.

Rhed wrote:All mammals don't share a common ancestor, and the field of phylogenetics show just that.
https://www.researchgate.net/publicatio ... 24_332-340

Many of the first studies to examine the con-
flicting signal of different genes have found considerable
discordance across gene trees: studies of hominids [9–11],
pines [12], cichlids [13], finches [14], grasshoppers [15] and
fruit flies [16] have all detected genealogical discordance so
widespread that no single tree topology predominates


Even though the flaw in this argument has been pointed out. I suggest reading the conclusion of the article about wether mammals or any other animal for that matter are related or not (spoilers: it doesn't say that at all).

And study Coalescence and incomplete lineage sorting. Or watch this lecture by PZ myers (skip to 29:40 to get to the relevant topic) or better yet watch it all.
"Ignorance more frequently begets confidence than does knowledge: it is those who know little, and not those who know much, who so positively assert that this or that problem will never be solved by science."
Charles Darwin
Last edited by Nesslig20 on Sun Aug 28, 2016 10:57 pm, edited 1 time in total.
Tue Aug 09, 2016 8:26 pm
RhedUser avatarPosts: 260Joined: Thu Jul 23, 2015 7:01 amLocation: Currently on the sofa Gender: Male

Post Re: Challenging Christian Hillbilly on evolution.

Nesslig20, you stated the following...

The theory of evolution: The unifying theory of biology that explains the unity and diversity of life and its history, in which life diversified via "Descent with modification" (aka evolution) from a series of flowering lineages connected by common ancestry; as well as explaining and describing why and how the process of evolution happens by several mechanisms like natural selection, sexual selection, genetic drift, etc. The theory overlaps and concords with several fields of science primarily biology: cellular biology, anatomy, especially genetics and taxonomy, but also geology and paleontology.

Here lies the problem. Both the Creation Model (forest of trees) and the Evolution Model (single tree) support similarity. Genetic drift is a decline of heterozygosity; opposite of upward evolution. Natural Selection only selects already existing genes. Also natural selection is a law in nature that attempts to explain everything, even with opposite outcomes. It explains why some organisms are fast and others slow. It explains why organisms produce more offspring and less offspring. Why flat earthworms are flat and why roundworms are round. This aimless force, natural selection, explains the ups, the downs, the ins, the outs, the sideways, and every way in between. The fossil record reveals that disparity precedes diversity; opposite of evolution predictions. The diagrams, pictures, drawings, etc. to prove the series of flowering lineages connected by common ancestry, are just that; i.e., pictures and diagrams with hypothetical lines connecting to hypothetical nodes arbitrarily arranged to conform to a prejudice view while ignoring mounting contrary evidence. The imaginary diagrams and imaginary pictures are only inferred and have little empirical support, which can be altered on the whim. What may be true today may not be true tomorrow. The one thing we all can agree on and be sure of about a fossil is that the organism once lived and then died. Find me a common ancestor of vertebrates and invertebrates, or unicellular and multicellular. The factual data and observations do not concord with the fields of science, e.g., genetics and paleontology, but explained away with rescuing devices (a conjecture designed to save someone's view from contrary evidences) and fudge factoring.

The common rescuing devices (ad-hoc explanations contrary to evolution predictions) used for common decent are the following examples:

E1: Convergence - similarity indicates ancestral relationship except when it doesn’t (the environment made me do it)

E2: Exaptation, or co-option – assume a shift in the function of a trait to explain away irreducible complexity and gradualism

E3: Lost Traits - shares characteristics to distant related species but not in closely related species

E4: Atavism - traits reappearing which had disappeared generations before (violation of Dollo’s Law)

E5: Horizontal gene transfer - I have it. My father has it. My sister…well, doesn’t have it. But my father's brother's nephew's cousin's former roommate has it. (Parody between Star Wars and Spaceballs)

E6: Rapid evolution - explains away the inconsistencies with the fossil record, molecular clock and mutation rates

E7: Punctuated equilibrium – the observation of the fossil record that shows abrupt appearances of species (stasis); opposite of Darwin’s predictions

E8: Ghost lineages - lineage that is inferred to exist but has no fossil record

E9: Incompleteness of the fossil record (a common go-to if all else fails)

E10: Incomplete lineage sorting (ILS) - discordant gene trees nested within a species

E11: Lamarckism, or Neo-Lamarckism.

E12: Conserved traits/sequences (coded and non-coded, which is a problem for genetic drift, population genetics, and neutral evolution)

Some of these rescuing devices are by far designed mechanisms, such as, co-option, as what we observe in bacteria. Bacteria are amazing in and of itself because of its gene swapping capabilities for survival. They are designed with genetic tools to alter their own DNA and to adapt to certain environments. Since bacteria have pan-genomes, they are even able to acquire genes from other strains. Most experiments that attempt to “prove” evolution are done by using bacteria, which in reality are designed to adapt, alter, modify and evolve (but with limitations).

As a side note for atheists to think about, if the Theory of Evolution is built on solely naturalistic causes, then one has to ask him/herself: Why would mindless random matter evolve enzymes for DNA repair? Think about that for a second. Why evolve an enzyme to check for errors (endonuclease) as if there is such a thing as corrections in a purely naturalistic world? Why in a naturalistic world would this enzyme cut the error nucleotide and mark it as if it had a purpose for doing it? Why would another enzyme (exonuclease) evolve to remove the error as if it had a goal in mind? Also why evolve the polymerase to place the correct nucleotide in the correct location as if there is a right and wrong nucleotide and location in a purely naturalistic world? Finally, the ligase enzyme apparently evolved to weld the pieces back together. The DNA repair kit in my opinion is the death knell of naturalistic causes of life. But this has nothing to do with falsifying common descent, so I digress.

However, I mentioned the DNA repair kit because it is a barrier for “Descent with modification”, which here is relevant.

But wait…there’s more…

“Descent with modification” has to prove why there are discontinuities at the molecular level of vital molecular machineries necessary for survival; for example, DNA replication, transcription, and translations. These cannot be interchanged between prokaryotes and eukaryotes. See E1, E2, E3, E5, and E10 for explaining away the contrary evidence. This evidence supports the forest of trees model.

“Descent with modification” has to prove why there are taxonomically restricted essential genes (epigenetics), that if one essential gene or an essential non-coding DNA doesn’t work properly the organism dies. There are domain specific essential genes i.e. eukaryotes-specific and prokaryotes-specific, that makes it highly unlikely they share a common ancestor. See E2, E5, E6, E11, and E12. Epigenetics supports the forest of trees model.

The presence of restriction systems is another hurdle for “Descent with modification” where an organism may contain restrictions enzymes that will cut foreign DNA introduced into a cell. This restriction system supports the forest of trees model.

Codon incompatibility, that is, UGA codes for tryptophan in bacteria, but in some eukaryotes UGA codes as a stop signal. This is not evidence for “Descent with modification”, but does support the forest of trees model.

Similarity supports both models, but discontinuity as well as mosaics needs to be explained via “Descent with modification”. According to Ockham’s razor, the Creation Model would be preferred. No need for the ad hoc explanations listed above.

Some ad-hoc explanations are not only darn right ridiculous but miraculous to adhere to “Descent with modification. Take Pac-6 gene for example. Organisms as diverse as jellyfish, arthropods, mollusks, and vertebrates all use this gene to control development of their very distinct types of eyes. Now you could believe that the Pac-6 gene evolved independently 40 times (Modern Synthesis, see E1 and E3), or believe in the Urbilateria that had all the tools needed for the limbs, eyes and hearts before they existed (evo-devo).

Another example of a miraculous moment in evolutionary history is Bioluminescence, which also evolved independently 40 times. Bioluminescent species are found in most of the major marine phyla from bacteria to fish. As a phylum, comb jellies have the highest proportion of bioluminescent species, whereas other phyla such as diatoms and arrow worms have none or few luminescent representatives. See E1 and E3 for explaining away evidence contrary to common descent.

If you assume “descent with modification” is a fact, then you must prove why two organisms could not arise independently although most scientific observations say otherwise.
If evolution was in the newspaper, it would be in the funnies
Sun Aug 28, 2016 4:44 am
he_who_is_nobodyBloggerUser avatarPosts: 3318Joined: Tue Feb 24, 2009 1:36 amLocation: Albuquerque, New Mexico Gender: Male

Post Re: Challenging Christian Hillbilly on evolution.

Rhed,

Rumraket, SpecialFrog, and I answered most of those questions you just posted in this thread back in January. Why ask them again on this forum?
_BONES AND FOSSILS = LOVE_
(_'--------------------'_)
(_.--------------------._)
Sun Aug 28, 2016 8:11 am
YIM WWW
RhedUser avatarPosts: 260Joined: Thu Jul 23, 2015 7:01 amLocation: Currently on the sofa Gender: Male

Post Re: Challenging Christian Hillbilly on evolution.

he_who_is_nobody wrote:Rumraket, SpecialFrog, and I answered most of those questions you just posted in this thread back in January. Why ask them again on this forum?


That's because the answers were never experimentally demonstrated; only inferred.
If evolution was in the newspaper, it would be in the funnies
Sun Aug 28, 2016 10:29 am
RumraketUser avatarPosts: 1170Joined: Fri Jun 25, 2010 7:49 am Gender: Male

Post Re: Challenging Christian Hillbilly on evolution.

Rhed wrote:The common rescuing devices (ad-hoc explanations contrary to evolution predictions) used for common decent are the following examples:

E1: Convergence - similarity indicates ancestral relationship except when it doesn’t (the environment made me do it)

Prediction, not ad-hoc rationalization. Besides, proposed convergent traits are tested for convergence rather than common descent when they can. And most, the vast majority of traits, aren't convergent.

You are focusing on the anomaly and ignoring the signal.

Even for the species in which a convergent trait is identified, the rest still overwhelmingly support common descent.

Rhed wrote:E2: Exaptation, or co-option – assume a shift in the function of a trait to explain away irreducible complexity and gradualism

It doesn't have to do with a shift in function or trait (though invariably that is often a result). It merely means a component already in existence, contributing to another function, also becomes part of a new one. Usually through gene-duplication. For example already existing enzymes are coopted into another pathway. Or structural proteins are coopted into another complex.

Besides, there has to be actual evidence for it. Nobody is claiming exaptation or cooption explain molecules for which no genealogical relationship to other molecules can be inferred.

Nobody is explaining away irreducible complexity. Rather we EXPECT irreducible complexity as a product of the evolutionary process. What is being explained is why IC is not evidence against evolution.

Rhed wrote:E3: Lost Traits - shares characteristics to distant related species but not in closely related species

Never heard of that one. Can you elaborate?

Rhed wrote:E4: Atavism - traits reappearing which had disappeared generations before (violation of Dollo’s Law)

Dollo's Law was inferred before it was known inheritance had a genetic basis one can model and analyze using statistics.

As such, it was subsequently modified to a statistical generalization (once the basis of inheritance was discovered and understood) that says it is merely improbable to see reversions, and the more exact and greater the reversion, the less probable it becomes. Notice this is how science has modified a statement in light of new evidence.

There is no known violation of this modified Law.

Of course, if evolution didn't happen, there simply shouldn't BE ativisms. If you take this to be a falsification of Dollo's Law, then by observation Dollo's Law is false but ativisms would still be evidence that life evolved.

Rhed wrote:E5: Horizontal gene transfer - I have it. My father has it. My sister…well, doesn’t have it. But my father's brother's nephew's cousin's former roommate has it. (Parody between Star Wars and Spaceballs)

This makes no sense. Maybe your bad parody ruined it.

HGT has a direct empirical basis. We can literally see that it happens.

Rhed wrote:E6: Rapid evolution - explains away the inconsistencies with the fossil record, molecular clock and mutation rates

All wrong. Nobody has ever suggested "Rapid Evolution" as an exaplanation for some percieved "inconsistencies" in the fossil record. Among other reaons because there ARE no inconsistencies in the fossil record. On matters of evolution, the fossil record is taken to be authoritative, so if there is an incongruency between the molecular clock and the fossil record, the molecular clock is wrong and the fossil record is right.

The molecular clock is a sort of yard-stick, not a laser-precision instrument. It gives rough estimations that can be useful. To make an analogy, In the area around the length of one yard, a yard-stick is fine, useful and sufficiently accurate. Once you go well beyond that, while you can still technically use the yard-stick, you will be introducing more and more measurement error the longer you go. That doesn't mean you should throw away the yard-stick, it's still useful, but there are other, much more precise tools out there for greater distances. Those would be analogous to the fossil record and rock dating techniques of various sorts. If you don't HAVE laser instruments for your chosen lineages, then you have no choise but to use the yard-stick. In such a case you can give rough approximations, but of course the dates should be taken with a grain of salt.

Rhed wrote:E7: Punctuated equilibrium – the observation of the fossil record that shows abrupt appearances of species (stasis); opposite of Darwin’s predictions

Is supposedly based on observation. How can observation of certain patterns in the fossil record be a "rescuing device"? That doesn't make sense.

Besides, PE is still rather controversial among paleontologists. I know someone with a degree in population genetics that claims he can show it is a prediction of population genetics. I read it, I didn't understand it, so what the hell do I know?

The only thing to say is that to call it a rescuing device or ad-hoc rationalization is a category error, when it is supposedly an observation.

Rhed wrote:E8: Ghost lineages - lineage that is inferred to exist but has no fossil record

And here we come to your first actual inference. One is hard pressed to see, however, in what way this represents a big problem for evolution. Most, as in almost all lineages, aren't ghost lineages, and those species for which a Ghost lineage is inferred, usually does have a pretty good reason for inferring it.

Rhed wrote:E9: Incompleteness of the fossil record (a common go-to if all else fails)

It is an observational fact that fossilization is extremely rare and that sedimentary rock erodes and alters over geological time. It would be rather idiotic to pretend the fossil record should be perfect in light of these facts. It would literally be like asking paleontologists to ignore what they know about the real world.

Rhed wrote:E10: Incomplete lineage sorting (ILS) - discordant gene trees nested within a species

That would be "within a group", not "within a species". You need at least three species to infer incomplete lineage sorting.

Besides, this one is a straight up prediction. It literally HAS to be true if evolution is true, and if no incomplete lineage sorting was detected then evolution would be wrong.

Rhed wrote:E11: Lamarckism, or Neo-Lamarckism.

You're talking about various forms of epigenetics here I guess. Then that'll be direct observation, not ad-hoc rationalization. How can something you observe happens be a rescuing-device? What has "neo-lamarckism" been used to "rescue" or "explain away"? Give examples.

Rhed wrote:E12: Conserved traits/sequences (coded and non-coded, which is a problem for genetic drift, population genetics, and neutral evolution)

How in the hell is sequence conservation a problem for "genetic drift, population genetics, and neutral evolution"? (Quick hint: it isn't). Please explain that.

Entertain me, Olé!
"Nullius in verba" - Take nobody's word for it. https://en.wikipedia.org/wiki/Nullius_in_verba
Extraordinary claims require extraordinary evidence.
Sun Aug 28, 2016 10:46 am
RumraketUser avatarPosts: 1170Joined: Fri Jun 25, 2010 7:49 am Gender: Male

Post Re: Challenging Christian Hillbilly on evolution.

Rhred wrote:Some of these rescuing devices are by far designed mechanisms, such as, co-option, as what we observe in bacteria. Bacteria are amazing in and of itself because of its gene swapping capabilities for survival. They are designed with genetic tools to alter their own DNA and to adapt to certain environments. Since bacteria have pan-genomes, they are even able to acquire genes from other strains. Most experiments that attempt to “prove” evolution are done by using bacteria, which in reality are designed to adapt, alter, modify and evolve (but with limitations).


You blather about ad-hoc rationalizations and rescuing devices, and then proceed to offer the motherload. This is all one big rationalization, designed to explain away the evidence for evolution, by pretending bacteria are somehow "designed" to be adaptive.

Are you literally built of irony?
"Nullius in verba" - Take nobody's word for it. https://en.wikipedia.org/wiki/Nullius_in_verba
Extraordinary claims require extraordinary evidence.
Sun Aug 28, 2016 10:56 am
RhedUser avatarPosts: 260Joined: Thu Jul 23, 2015 7:01 amLocation: Currently on the sofa Gender: Male

Post Re: Challenging Christian Hillbilly on evolution.

Rumraket wrote: You blather about ad-hoc rationalizations and rescuing devices, and then proceed to offer the motherload. This is all one big rationalization, designed to explain away the evidence for evolution, by pretending bacteria are somehow "designed" to be adaptive.

Are you literally built of irony?


Hello Rumraket,

Great to talk with you again. Having the ability to adapt is an intelligent feature, not a natural random feature. The rescuing devices I've mentioned are ALL intelligent features. If you want to strictly use natural causes, then the whole process should be natural causes. There can be no planning, or any kind of purpose or goal in mind. You cannot invoke the bacteria figured out such and such, or learned how to such and such. (When I say you, I mean evolution).

Also most of the ad-hoc explanations have to do with explaining away contrary evidence of common descent. If you take away common descent, the ad-hocs disappear like a fart in the wind. The reason your eyes and the octopus eyes are similar is because of a common designer; not because of convergence. Intelligent engineers use this type of method; that is, modular.
If evolution was in the newspaper, it would be in the funnies
Sun Aug 28, 2016 11:50 am
RumraketUser avatarPosts: 1170Joined: Fri Jun 25, 2010 7:49 am Gender: Male

Post Re: Challenging Christian Hillbilly on evolution.

Rhed wrote:As a side note for atheists to think about, if the Theory of Evolution is built on solely naturalistic causes, then one has to ask him/herself: Why would mindless random matter evolve enzymes for DNA repair?

Because there is natural selection against deleterious mutations. Any organism that can reduce it's error rate by even very small amounts, will over long timescales have a fitness advantage.

So to comment on your first sentence, someone already HAS thought about it and solved it. You're sitting here now and discovering a problem that was solved literally half a century ago. If not more.

Rhed wrote: Think about that for a second.

I have, how about you think about it for two?

Rhed wrote:Why evolve an enzyme to check for errors (endonuclease) as if there is such a thing as corrections in a purely naturalistic world? Why would another enzyme (exonuclease) evolve to remove the error as if it had a goal in mind? Why in a naturalistic world would this enzyme cut the error nucleotide and mark it as if it had a purpose for doing it?

Because those that do not, leave fewer offspring, because their genes have more deleterious mutations in them, making them less efficient.

Natural selection. What you fail to consider is natural selection.

Organism one does not have a mtuation that affects it's rate of mutation.
Orgamism two has a mutation that affects it's rate of mutation to be slightly lower.

When organism one divides, the daughter cell will have, say, 40 mutations. 30 of them will be deleterious, the rest are neutral, none turned out to be beneficial this generation.

When organism two divides, the daughter cell will have the mutation that lowers the mutation rate, so it will only have 20 mutations. But since it had fewer mutations, but the proportion of mutations that are deleterious remains the same, so it has 15 deleterious mutations, 5 neutral, no beneficial.

So Daughter-One has 30 deleterious mutations, and daughter-two has 15 deleterious mutations. Which one has highest fitness? Obviously the one with only 15 deleterious mutations.

What is fitness a measure of? Reproductive success. So who will go on to have the most offspring? Daughter-Two.

Over generations, mutations still slip in here and there, and by chance another will happen that affects the mutation rate, lowering it even further. The same scenario repeats itself. The one with an even lower mutation rate, will have even fewer total deleterious mutations than it's competitors, thus have higher on-average fitness, produce more offspring, which eats all the food faster and so on.

That's how DNA repair evolves through a blind natural process without goals or intent.

Rhed wrote:Also why evolve the polymerase to place the correct nucleotide in the correct location as if there is a right and wrong nucleotide and location in a purely naturalistic world?

Because of natural selection. The organisms that make many errors will over time accumulate more deleterious mutations, leading to lower overall fitness. Eventually this will result in them being outcompeted and forced to extinction by their cousins that had lower rates mutations, since this will directly result in a lower total amount of deleterious mutations.

Rhed wrote:Finally, the ligase enzyme apparently evolved to weld the pieces back together. The DNA repair kit in my opinion is the death knell of naturalistic causes of life.

Then I submit that you have in fact utterly failed to even think about it. At all.

You are probably suffering from a psychological condition informally called the discontinuous mind.

You see everything in black and white, either-or, on-off. There are no gradations in between. You fail to consider the concept of a gradual improvement. To you there is either complete nonfunctionality, or amazing and functional design.

Rhed wrote:However, I mentioned the DNA repair kit because it is a barrier for “Descent with modification”, which here is relevant.

In what way is it a barrier to descent with modification?

Here are three empirical facts which are not in dispute by anyone:

1. Bacteria copy their genome to their offspring every cell division.
2. Bacteria suffer mutations.
3. Bacteria have DNA repair mechanisms that are very good, but not perfect at detecting and correcting mutations

So there is descent (the DNA is copied).
There is modification (it has mutations in it).
There is some error correction (most of the mutations are detected and fixed).

Here comes the gradualist alternative your mind has prevented you from seeing: The error correction mechanisms AREN'T PERFECT.

MOST of the mutations are detected and fixed, but NOT ALL of them.

If you shut off the error correction machinery, the error rate will simply increase from something very low (something on the order of 1 nucleotide in every 100 million), to something slightly higher (1 in 10 million or 1 in 5 million). It doesn't go from zero to instantly lethal.

This is your mistake, the black-and-white thinking. That it must either be fully one, or fully the other, and nothing in between is possible.

The very thing that is giving bacteria these adaptive properties that you claim they are designed with, is what makes descent with modification possible.

One will naturally be led to ask (and yes, evolutionary biologists asked this too), why has the mutation rate not gone to zero? After all, NO deleterious mutations is better than a few deleterious mutations.

Yes it is. But if it went to zero, the bacteria would also lose their adaptive ability. There HAS to be some way to allow a bit of change, on the off chance that something useful can happen. Because the environments the bacteria live in, in the wild, are constantly changing, so in a funny turn of fate, the long-term cost of a perfect replication machine is a complete loss of adaptive capacity.

Because the frequency of mutations that affect the mutation rate itself, is very very low, this means it takes many many generations for mutations that affect the mutation rate, to appear.
So even if a single bacterium actually manages to evolve a perfect mutation rate, chances are most of it's cousins have not, so they will persist alongside each other for many generations and maybe the one with a perfect replication rate has sliiightly higher fitness, but it is not enough to render it's cousins extinct in the time available, but now suddenly the environment changes and the bacteria are not well-adapted to this sudden change. Guess who now has a higher chance of having offspring that are better adapted to the changed environment? Those that can still mutate, because their error-correcting machinery is not perfectly accurate so they still have some chance of getting an adaptive mutation.

For bacteria like E coli, the mutation rate is normally so low that on average, only one in every 25 new bacteria carries a single mutation. (The typical e coli genome is about 4 megabases, the mutation rate is ~10-8)

That means most cell divisions for E coli are perfect copies. So the repair machinery is so good it takes multiple rounds of replication for a single mutation to creep in. But it does creep in, and this is what gives the capacity for change. There are hundreds of billions of bacteria in bacterial populations, so there are still thousands of mutants among them.
"Nullius in verba" - Take nobody's word for it. https://en.wikipedia.org/wiki/Nullius_in_verba
Extraordinary claims require extraordinary evidence.
Last edited by Rumraket on Sun Aug 28, 2016 5:01 pm, edited 2 times in total.
Sun Aug 28, 2016 11:52 am
RhedUser avatarPosts: 260Joined: Thu Jul 23, 2015 7:01 amLocation: Currently on the sofa Gender: Male

Post Re: Challenging Christian Hillbilly on evolution.

Rhed wrote:E5: Horizontal gene transfer - I have it. My father has it. My sister…well, doesn’t have it. But my father's brother's nephew's cousin's former roommate has it. (Parody between Star Wars and Spaceballs)


Rumraket wrote:This makes no sense. Maybe your bad parody ruined it.

HGT has a direct empirical basis. We can literally see that it happens.


The good example would be echolocation in bats and whales.

The echolocation abilities of bats and whales, though different in their details, rely on the same changes to the same gene – Prestin. These changes have produced such similar proteins that if you drew a family tree based on their amino acid sequences, bats and toothed whales would end up in the same tight-knit group, to the exclusion of other bats and whales that don’t use sonar.

This is one of the most dramatic examples yet of ‘convergent evolution’, where different groups of living things have independently evolved similar behaviours or body parts in response to similar evolutionary pressures.

That hurt when you said my parody was bad and it ruined it. :cry:
If evolution was in the newspaper, it would be in the funnies
Sun Aug 28, 2016 12:01 pm
RumraketUser avatarPosts: 1170Joined: Fri Jun 25, 2010 7:49 am Gender: Male

Post Re: Challenging Christian Hillbilly on evolution.

Rhed wrote:
Rumraket wrote: You blather about ad-hoc rationalizations and rescuing devices, and then proceed to offer the motherload. This is all one big rationalization, designed to explain away the evidence for evolution, by pretending bacteria are somehow "designed" to be adaptive.

Are you literally built of irony?


Hello Rumraket,

Great to talk with you again. Having the ability to adapt is an intelligent feature, not a natural random feature.

Prove it.

Rhed wrote: The rescuing devices I've mentioned are ALL intelligent features.

Prove it.

Rhed wrote: If you want to strictly use natural causes, then the whole process should be natural causes.

This isn't about what I want.

Rhed wrote:There can be no planning, or any kind of purpose or goal in mind.

I agree, in evolution there is no such thing.

Rhed wrote:You cannot invoke the bacteria figured out such and such, or learned how to such and such. (When I say you, I mean evolution).

What does that even mean? "Invoke the bacteria figuredout such and such"?

I can explain how something could evolve through the common evolutionary principles of mutation and natural selection. I do.

Rhed wrote:Also most of the ad-hoc explanations have to do with explaining away contrary evidence of common descent.

There isn't any contrary evidence to common descent. For there to be contrary evidence there'd have to be a competing hypothesis that makes quantifiably testable predictions. There isn't.

Intelligent Design amounts to a one-line rationalization without any shred of a mechanistic detail that has explanatory power. It is a band-aid, a place-holder answer that amounts to nothing but two words put together. As such, it doesn't even qualify as an explanation, because it offers no actual explaining. There is no how, or why, or when.

It's just "design" full stop. How did octopi come to exist? Design. Okay, how? Dunno, just design.

Wow, what a great theory you have there. Really intellectually satisfying. Something exists because it was "designed". *POOF* and there it was, fully functional, complete as-is. It just appeared there overnight. Possibly in an instant. That's "design". I think you should read this: http://theskepticalzone.com/wp/phylogeny-the-bigger-picture/comment-page-1/#comment-131053

On intelligent design you expect NOTHING IN PARTICULAR. All patterns are possible, but no pattern is any more expected than another unless you already know something about what goes on in the mind of the designer(do ID proponents happen to know that their intelligent designer WANTS to design nesting hierarchies? No they don’t, it’s just an ad-hoc rationalization).

All patterns are after-the-fact compatible with design, but none of them are exclusively or statistically predicted to appear over others when the designer and it’s methods are unknown.
Yes, design CAN explain all the same observations as evolution by common descent. But only in an empty and ad-hoc fashion that lacks explanatory power. (As in, it doesn’t actually explain or predict why we see what we see).“That’s just the way the creative designer wanted to make it”. There is no WHY or HOW in the design-rationalization. It is nothing BUT a rationalization come up with after the fact of discovery of nesting patterns of similarities.

Further more, why do human beings (the only intelligent designer we know of empirically) use “common design”? Mostly to save time and resources. Human beings copy previous designs because it is simply faster to do so when they need to make something that works. Nuts and bolts are reused because they work fine as they are, no need to change them. They are standardized, the factory has no good reason to invent new, sliiiiightly different ones every time (the same way we see, for example, regulatory regions mutate over time and phylogenies being constructible therefrom). Wheels are good for vehicles, easy to copy the basic pattern and save time, instead of having to re-invent a new method of locomotion every time. And build an entirely new factory to produce them.

But, life wasn’t designed by humans, so we can’t use analogies to anthropomorphic tendencies with respect to design. The kind of designer most ID proponents think designed life is an omnipotent supernatural designer, unconstrained by a faulty or mediocre imagination, unconstrained by a lack of time, unconstrained by resources, unconstrained by materials or anything at all. Such a designer would have absolutely no practical reasons for copying it’s designs over and over again in a derivative fashion by re-using and slightly altering items and structures from previous designs, to include in new organism that appear as evolved derivations of previous ones. None of the inferences we use to infer human design took place, are valid inferences for an unconstrained, omnipotent divine designer who does not have human concerns of practicality such as resources, lack of intelligence, imagination, creativity and time.

So there is a colossal ambivalence at the heart of the main ID proponents, who start with a conclusion that a specific and supernatural designer did the designing. This leads them into problems very quickly, for among other reasons that the nature, capacities and intentions of their designer, they assert, is unknowable, infinite and mysterious, respectively.

But in science we work with what we got and from what we know:
Observed designers, observed natural processes, observed manufacturing processes leaving observational evidence behind. The mechanism is understood, it makes testable predictions. It fits into already well-established frameworks of science from other fields: Physics, chemistry etc.(And in the case of human designs, human psychology, human inventions and technology and human culture). We can then form hypotheses and look for the results of the mechanism and either confirm or falsify the hypothesis.

Now comes “ID”. Do it have a mechanism? Nope.

What did it make? Depending on who you ask, all living organisms as-is, or occasionally it just dropped in to magically instantiate specific mutations at various points in the history of life, or zap a flagellum into existence.

Does their designer leave a signature, product description or trademark behind?(Stainless Steel, Goodyear, Firelli, Made in Taiwan, Nike, Microsoft, Coca Cola, nVIDIA… ) Nope.

Does it use tools? Nope (or no idea, things magically appear with no process of fabrication and construction).

When did it operate? No idea, millions and billions of years ago and now it’s suddenly stopped entirely no new creations take place. No creation has ever been observed. No macro-creation, not even micro-creation. Simply put, we observe absolutely nothing at all that looks like it is being instantly created with divine magic.

Do they draw analogies to human manufacturing processes? Well, they sometimes say that the designer re-uses old designs. What reasons do they have to expect their designer to do this? Since they don’t know the designers mind or intentions (they keep saying this to secular audiences), then they must be getting their idea from having seen human beings design things.

Ok, let’s just run with that. Let’s try the “accepts common descent and some degree of evolution but occasionally dropping in to make specific mutations happen by screwing with atoms at the quantum-level” (theistic evolution ala Kenneth Miller’s ideas). What testable predictions does this make? It should look exactly like evolution happened.
Just like evolution could have created all of life through mutations, drift and selection, with all the minor quirks and oddities being the result of incomplete lineage sorting, convergent evolution, drift, horizontal gene transfer and so on,
all expected to happen but never statistically significantly deviate from the main pattern, so does theistic evolution become observationally indistinguishable from naturalistic evolution.

In other words, an unobserved designer operating in the deep geological past, on a global scale, who has the ability to make specific mutations happen inside living organisms, is in competition with the observed fact that evolution happens naturally:

A) Mutations observationally happen, and we have no good reason to think they wouldn’t in the past too.
B) Those mutations affect the morphology and the physiology of the host organisms, and we have no good reason to think they wouldn’t in the past too.
C) The phenotypical and morphological effects of those mutations affect the reproductive successs of the carrier organism, and we have no good reason to think it wouldn’t in the past too.
So simply put, drift and selection observationally happens, and we have no good reason to think it wouldn’t in the past too.
E) Environments observationally change, and we have good reason to think they did in the past too (all of geology and the Earth-sciences testify to this).
F) Horizontal gene transfer observationally happens, and we have no good reason to think it wouldn’t in the past too.
G) Incomplete lineage sorting observationally happens, and we have no good reason to think it wouldn’t in the past too.
H) Convergent evolution observationally happens, and we have no good reason to think it wouldn’t in the past too.

Which is the simplest, most parsimonious explanation of the observed shared derived characteristics in extant life, then? The observed one that doesn’t require us to erect uneconomical unobserved entities: Evolution.

Ok, fuck that then. Moving on to the “all life made as-is” (space-aliens with superduper technology-ID-creationism).

Well, we should expect to find similarities between some species(still re-using old designs).
Ok, we find that. But we have at least two hypotheses that predict this same feature, so can we distinguish between them? Well, evolution predicts congruent nesting hierarchies in morphology, anatomical features and genetics.

But designers have been known to design nested hierarchies too.

Sure, but again the reasoning is arrived at ad-hoc. Mere re-using of old designs should not in itself yield highly congruent multiple nesting hierarchies into which all of life fits to an extremely high degree of confidence.

No, but it still could have been designed.

Yes! But why would we believe it was beyond the mere possibility? What grounds are there to believe that this is what happened?What are the odds that, even if you as a “designer” sits down and thinks “I’m going to reuse some of my older designs”, inadvertently produces a nested hierarchy, into which every species on the planet fits, both genetically, morphologically (and chronologically in the fossil record)? And why would you do it deliberately? What are the odds that your designer sat down and designed this specific pattern?

Does the observed nested hierarchy even make sense with respect to known, human designers method of design and manufacture?

Let’s see:
A look into the mind of the designer of the nested hierarchy:
“Common design – common designer” (by deliberately forming sets within sets within sets).

Here’s a small insight into it’s train of thought (courteously trying to give ourselves reason to entertain the design hypothesis by drawing from the only intelligent designer we know of – Homo Sapiens):

Oh, I’m going to design a bacterium with a genome like this (the first genome!).
AAAGGGCCCTTTAAGGCCTTAGCT

Oh, I want to design another organism, re-using some of my bacteria designs(the “common designs”-argument), so it looks like this new organism genetically and morphologically mostly derives from the first one.
AAAGGGCCCTTTAAGGCCTTAGCA

Oh, I’m going to design a 3rd organism, this time re-using designs from the 2nd organism, so it looks like it mostly derives from the 2nd one.
AAAGGGCCCTTTAAGGCCTTACCA

Oh, I’m going to design a 4th organisms, this time re-using designs from the 3rd, so it looks like it mostly derives from the 4th one.
AAAGGGCCCTTTAAGGCCTAACCA

Oh, I’m also, intermittently, going to go back and re-tweak my previous creations, so that it looks like they each independently changed since I first created them.
1st Organism: TAAGGGCCCTTTAAGGCCTTAGCT
2nd Organism: ATAGGGCCCTTTAAGGCCTTACCA
3rd Organism: AATGGGCCCTTTAAGGCCTTACCA
4th Organism: AAAGGGCCCATTAAGGCCTAACCA

Not only am I going to do this, mysterious designer as I am, I’m going to do it in such a way that the degree of change it looks like they underwent, is directly proportional to how old their time of divergence will look like if calculated from number of nucleotide substitutions(and estimated from the fossil record). Haha, take that – future humans whom I’m going to create at some point too!

Anyway, back to business, creating a 5th organism, this time re-using designs from the 4th, so that it looks like it mostly derives from the 4th one.
ACAGGGCCCATTAAGGCCTAACGA

Oh, I just got a brilliant idea! I’m going to go back to the first organism I designed, and then derive a whole new “branch” from it. But I’m not going to be deriving this branch from the original genome I first created, no, I’m going to change it slightly so it looks like that first genome evolved for a time before this new “divergence” happened, THEN I’m going to make the new “branch”.
1) TTAGCGCCCTTTAAGGCCTTAGCT
1a) TTAGCGCCCTTAAAGGCCTTAGCT (independently derived from 1)
1b) TTAGCGCCCTTTATGGCCTTAGCT (independently derived from 1 also)
There, perfect!

Oh, I just got another brilliant idea. In addition to the intermittent return to tweaking the genomes of previously designed organisms, I’m going to do the exact same I just did to the first lineage: Intermittently derive more independent branches off of each of the 2nd, 3rd, 4th, 5th (and so on) “linages” I created, using the same hilariously illogical method I just used to create a branch off of the 1st one. Brilliant!

And I’m going to do this for millions and millions and millions of species. And to top it all off I’m going to kill billions of them in intermittent extinction events, burying them in the millions in seemingly temporal order matching with morphological and genetic sequence, so that it just so happens to look like they left incrementally changed descendants over a very long timescale.

I wonder what the odds of me creating and designing life, exactly using this method is? I wonder if it even makes sense to postulate that anything would do “design” like this? Hmmm.


Does this make sense to postulate? No, it doesn’t. No mentally healthy intelligent designer would operate like this and produce a nested hierarchy indistinguishable from the one produced by the evolutionary process.

I submit that if you can convince yourself that your designer operated like this, then you’re either insane, deluded or infinitely gullible. Regardless, it would be irrational to believe it.

Rhred wrote:If you take away common descent, the ad-hocs disappear like a fart in the wind. The reason your eyes and the octopus eyes are similar is because of a common designer; not because of convergence.

How do you know that? How do you test that?

Last I heard, they aren't really similar except in the sense that they're both eyes used for sight. And that octopus eyes are actually quite different from human eyes, and superior in a variety of ways.

Rhed wrote:Intelligent engineers use this type of method; that is, modular.

I don't know of any 800 million year old engineers. Where can I go visit these people?
"Nullius in verba" - Take nobody's word for it. https://en.wikipedia.org/wiki/Nullius_in_verba
Extraordinary claims require extraordinary evidence.
Sun Aug 28, 2016 12:04 pm
RumraketUser avatarPosts: 1170Joined: Fri Jun 25, 2010 7:49 am Gender: Male

Post Re: Challenging Christian Hillbilly on evolution.

Rhed wrote:
Rhed wrote:E5: Horizontal gene transfer - I have it. My father has it. My sister…well, doesn’t have it. But my father's brother's nephew's cousin's former roommate has it. (Parody between Star Wars and Spaceballs)


Rumraket wrote:This makes no sense. Maybe your bad parody ruined it.

HGT has a direct empirical basis. We can literally see that it happens.


The good example would be echolocation in bats and whales.

The echolocation abilities of bats and whales, though different in their details, rely on the same changes to the same gene – Prestin. These changes have produced such similar proteins that if you drew a family tree based on their amino acid sequences, bats and toothed whales would end up in the same tight-knit group, to the exclusion of other bats and whales that don’t use sonar.

Didn't you invoke this crap before and get schooled on it back then? Maybe it was someone else. Look around, can't be bothered going through this crap all over again. I really should just start saving my posts and copy-paste responses, you people never learn anything. It's like your brains have reset-switches you hit after every discussion we have. You come, stary around for a spanking for a few weeks, then return months later with the EXACT SAME SHIT all over again.

What the hell is wrong with you?
"Nullius in verba" - Take nobody's word for it. https://en.wikipedia.org/wiki/Nullius_in_verba
Extraordinary claims require extraordinary evidence.
Sun Aug 28, 2016 12:09 pm
RhedUser avatarPosts: 260Joined: Thu Jul 23, 2015 7:01 amLocation: Currently on the sofa Gender: Male

Post Re: Challenging Christian Hillbilly on evolution.

Rumraket wrote:
Prove it.


Ok. But first allow me to commend you on your ludicrous ridiculous fast typing skills.

I have to run, but the post below is the best way of explaining it..

This is a copy/paste from poster forexhr from uncommon descent:

One of the ways to refute Darwin’s theory is to show that evolution can build things by random chance alone and that natural selection has absolutely nothing to do with it, since even the most ardent advocates of evolution admit that organisms complexity is orders of magnitude too improbable to have come about by chance.

In order to successfully demonstrate this point we first have to define the meaning of the word “solution” in biology, of course in the context of evolution. Since the DNA is a molecule that carries most of the genetic instructions used in the development and functioning of all known life, the solution in biology is nothing but some arrangement or combination of nucleotides in a DNA. To be more precise, it is the combination of nucleotides that contains the information on how to build some biological structure with the ability to cope with a particular problem at the level of environment, cell or the whole organism.

Let us now look at some examples to illustrate this point. Imagine that we have an ecological or environmental area that is inhabited by some organisms. Sources of food in this area are drying up and population of organisms is introduced into a new environment. In this new environment there is a plenty of energy rich substances. But, the problem is that genes for metabolic pathway to convert this substance into usable energy do not exist in a gene pool of that population. Metabolic pathway that can convert this new food into usable energy consists of 2 enzymes. So the information on how to build those enzymes is not present in the DNA, just like information on how to build eyes was not present in the genetic material of the first self-replicating organism. So, here evolution needs to find a solution to this problem which means, evolution needs to find the right combination of nucleotides in the DNA so that cell can produce functional enzymes with the ability to convert new energy rich substance into a usable energy. Once this is done and solution enters the gene pool, natural selection can kick in and spread this new solution through the population. So, this was an example of finding a solution in the context of the environment or by filling of ecological niches.

For the problem solving at the intracellular level we can use intronic insertions problem. Genes of today’s eukaryotic cells are interrupted by noncoding sequences called introns that need to be removed via splicing machine from the RNA molecule before the process of protein synthesis can begin otherwise they would destroy the protein-coding capacity of genes. So, from the evolutionary point of view the splicing machine is the complex evolutionary solution to the intron insertions problem, that began early in a cellular live, once one of these early cells get one of these introns inserted into a critical gene.

Now that we know what the concept of solution in biology is, we can turn towards the critical point of this demonstration and show why fundamental assumption behind darwin’s theory of evolution is false.
We will do that with the help of one simple analogy in the context of previous intronic insertions example. By using this analogy we will try to solve one problem via evolutionary mechanisms. Ok, let’s start.

Imagine that someone offers to pay you one million U.S. dollars if you can provide the correct answer to the question written down on paper. So, you will be rewarded if you provide the right combination of letters, just as the cell in our intron insertions example would be rewarded if evolution provides the right combination of nucleotides in the DNA with the information to make splicing machine. The principle is the same in both problems.

In answering a question you are allowed to use whatever method you want. You can use encyclopedias and textbooks, you can do a Google search, you can conduct science experiments, communicate with other people, and so on. But, you have only one constraint – you are required to use mechanisms of Darwinian evolution. You say, ok, I am fine with that, evolution is a powerful method of finding solutions, as demonstrated in nature and by evolutionary programming so this shouldn’t be a problem.

Finally you ask: so what is this million dollar question? And the person replies: well, you are not allowed to see the question. Remember, you are required to use mechanisms of evolution. And we know that evolution have no intelligence and no mind so evolution can’t see, read, think, percieve,… evolution cannot grasp the problem. The only thing evolution can do in finding solutions is a random shuffling of nucleotides in the DNA and once the solution emerges natural selection process can kick in and spread this solution through the population. In the same way, you are alowed to combine existing letters, words and sentences that exist in books, newspapers, magazines,dictionaries, internet or in your mind. You can do whatever you want in creating new combinations of linguistic elements. The only constraint is your inability to use engineering and inteligent design principles in solving a problem. You are unable to notice or become aware of the question, or in other words, you are unable to create a mental representation of perceived question and then, using your cognitive faculties, to co-opt the right combination of letters, words and sentences according to this mental representation. In short, no intelligence is allowed.

Now you just thing about the extent of the problem. The subject of the question can be any aspect of the reality that can be expressed in words. So there is a potential for nearly infinite number of potential questions. And since you do not know what the question is you don’t know what words or letters to use, how to combine them, you don’t know what amount of words constitute the correct answer. You just pick letters and words randomly, put them together randomly and hope the correct solution will pop up, so that you can win a million dollars.

Also, in this process you are not able to communicate with the asker about a partial accuracy of the answer since communication is intelligent activity, and we know that evolution does not have intelligence and therefore its not able to communicate. In our intron insertions problem, solution consists of at least five subprocesses: to recognize mRNA and its intron-exon boundaries, then to cut the RNA, to rearrange cuted parts, to join and finally to release the mRNA molecule. Only when combination of nucleotides in the DNA that contains all five subprocesses exists only then natural selection can act. And not before. For example: If we assume the existance of splicing helper proteins that assembly at the intron-exon borders to guide small nuclear ribo proteins to form a splicing machine, this partial correctness of the splicing process won’t cause introns to magically disappear without a complete splicing machine. This partial correctness won’t cause random, blind and unintelligent process to put aside these helper proteins because they’re good for the future splicing function. Evolution has no long term goal, it cannot plan. There is no long distance target to serve as a criterion for selection.

In the same way you will be selected by the author of the question and rewarded one million dollars only when complete and acurate answer is provided. Selection process cannot help you in finding solution. If that is the case then the only available way for you to find a solution is by pure chance. At this poin we can clearly conclude that evolution is refuted since there are 10^390 possible dipeptides for a single average protein of 300 amino acids. Since less than 10^90 of them exist as clusters of active proteins, even if all physical events that have occurred in the thermodynamic lifespan of the observable cosmos were used to find a single average protein, the probability of finding this single protein is less than a 10^150. So, to find even one average protein by chance is like winning the same lottery with the same numbers 20 times in a row.

Finally, we will unmask the empty rhetoric and logical flaws behind the rationalizations invoked in the “covering up” of the fact that evolution proceed by random chance alone. Besides mentioned, natural selection, this rationalizations are usage of terms like “functional shift,” “exaptation,” “co-option”. We will se how absurd they sound when they are put alongside our previous examples. At the end we will see how intelligent design is presuposed in the rationalization called evolutionary algorithms.

Functional shift is an idea in evolutionary biology where some cellular or morphological element adopts a new function. And this is said to be the process by which evolutionary novelty is generated. In the words of our analogy, you are alowed to change one semantically correct word into another, or one syntactically correct sentence into another so that existing words and sentences adopt new semantic or syntactic function or meanings. But, what that has to do with providing the right answer?? Absolutly nothing. The problem is not in creating some new random and functional word or sentence the problem is creating words and sentences which will allow you to win one million dollars. In the same way the problem in biology is not in creating some new random function, problem is in creating function that solves a particular enviormental or intracellular problem, like enzymes with the ability to convert new food into usable energy or molecular machine with the ability to cut introns.
So the claims like: the acquisition of new functions by molecules involved in developmental pathways is suspected to cause important morphologic novelties…
http://www.ncbi.nlm.nih.gov/pubmed/10376014
…are nothing but empty claims. They are like saing: the acquisition of new meaning by words involved in writing a novel is suspected to cause important linguistic novelties. So, proponents of evolution completely ignore the question of how evolution finds the solution. Instead, they just appeal to the empty terms and abstract hypothetical scenarios that do not exist in reality.

Second therm, co-option, says that the parts nessecary to create molecular machines could be taken from other molecular machines and combined into the new machine being constructed. In the words of our analogy this is like saing: words nessecary to create the correct answer could be taken from dictionary or some textbook. As we can see, this is again completely irrelevant since the problem is not in creating the new combination of words. Problem is in creating the correct combination of words in the space of nearly infinite number of possible combinations. But there is also another problem. The co-option argument presupposes that all functional parts already exist. But this is not evolution. The hypothetical first self-replicator, which is the starting point of the evolution, did not contain genes for three-dimensional cellular structures and arrangements like organs or organ systems. You cant co-opt parts of the organism like bacteria and expect kidneys to emerge. In the context of our analogy this is like using only 1 percent of the dictionary and then trying to evolve new words by randomly shuffling letters of existing words. Now imagine that after the long, long shuffling process, finally one semantically correct word pops up. This is like evolving one new functional protein for future splicing process. Since you dont know what the question is, this new word is completely useless to you. The potential for providing the correct answer and win one million dollar by using this new word is the same as using any other functional word. So, the ability to evolve new functional proteins does nor explain problem-solution relationship that we observe at every level of biological organization.

Finally, we will demonstrate how proponents od evolution implicitly presuppose existance of inteligence in their explanations. They are doing this when claiming that programming techniques known as genetic algorithms mimic biological evolution as a problem-solving strategy. We will first ask a question: can you solve your million dollar question by using evolutionary algorithms. Of course not, because you dont know what the question is so you are not able to calculate fitness. To calculate fitness you have to comunicate with the asker, but we know that communication, which is an intelligent activity, is not available to evolution.

To ilustrate this consider the following example: you start with population of 20 individuals located at the center of the soccer field. Individuals will be rewarded(selected) if they manage to reach the right corner of the field using the following metod: they are alowed to move one step at a time, in one of four different directions; left, right, forward, or backward. Direction of every step is determined randomly. We know that chances od finding solution by using this type of random search are extremely low. This is similar of answering our million dolar question by chance.
But, we can do the following. We start our simulation and every individual is randomly moved one step in one of four mentioned directions. When this is done we measure the distance between individual and the right corner of the field. We repeat this calculation for every individual. Now using this data we calculate fitness of each individual. Next step is the selection process. We want to be constantly improving ourindividuas overall fitness. Selection helps us to keep the best individuals in the population – so individuals who are most distant from the corner are out. Now we have our next generation and we can start again the whole procces until we reach the right corner.

Without further elaboration, we can easily see what technique is used here. At each step of the simulation we have a communication bettwen a solution and the current state of the individual. In other words, we have an a priori knowledge of the solution before the solution is reached. Without this a priori knowledge about the search space structure evolutionary programing does no better than blind search.
The use of a priori knowledge is called planing. Plan is defined as a set of actions that have been thought of as a way to do or achieve something. By creating plans we, as inteligent agents, are creating solution before the solution exists. This solution or representation to show the construction or appearance of something, is created in the form of architectural blueprints, engineering drawings, schemes, models, prototypes and so on. Then, by using our cognitive faculties we design objects by comparing this plans with a current state of the object. In short, this activity is called inteligent design.
So the proponents of evolution are explaining the power of evolution to the general public by attributing the design methods of intelligent agents to evolution.

Best example of this manipulation is Dawkins weasel program presented in chapter 3 of his book The Blind Watchmaker. Dawkins knows that a purely random approach to generating biological solutions is theoretically impossible, due to the excessively huge search space. So he created WEASE program where he aims to show that the process that drives evolutionary systems — random variation and natural selection — is different from pure chance. So, how he did it? Short answer. By inteligent design. Now, long answer. Program begins by choosing a random sequence of 28 letters, it duplicates it repeatedly, but with a certain chance of random error – ‘mutation’ – in the copying. The computer examines the mutant nonsense phrases, the ‘progeny’ of the original phrase, and chooses the one which, however slightly, most resembles the target phrase, METHINKS IT IS LIKE A WEASEL. By repeating the procedure, a randomly generated sequence of 28 letters and spaces will be gradually changed each generation until target phrase “METHINKS IT IS LIKE A WEASEL” is reached.

Here Dawkins is using an a priori knowledge of the target phrase or solution – METHINKS IT IS LIKE A WEASEL- and then in each generation of selective ‘breeding’, the mutant ‘progeny’ phrases were judged according to this target phrase. So, Dawkins proved that the process that drives evolutionary systems is different from pure chance by using engineering principles and methods of inteligent design.
Now here’s an interesting consequence of this manipulation with evolutionary programing. When creating arguments about the creative power of Darwinian evolution, proponents of evolution are implicitly presupposing the existence of intelligence. And then in the conclusion of the argument they are denying the existence of intelligence, and in the same time they mock people who are claming that living things are best explained by an intelligent cause. Isnt that intresting?
If evolution was in the newspaper, it would be in the funnies
Sun Aug 28, 2016 12:43 pm
RhedUser avatarPosts: 260Joined: Thu Jul 23, 2015 7:01 amLocation: Currently on the sofa Gender: Male

Post Re: Challenging Christian Hillbilly on evolution.

Rumraket wrote:Didn't you invoke this crap before and get schooled on it back then? Maybe it was someone else. Look around, can't be bothered going through this crap all over again. I really should just start saving my posts and copy-paste responses, you people never learn anything. It's like your brains have reset-switches you hit after every discussion we have. You come, stary around for a spanking for a few weeks, then return months later with the EXACT SAME SHIT all over again.

What the hell is wrong with you?


It wasn't me it was someone else. I know I am getting to you, getting to you. One day though, you will thank me and kiss my butt knowing I was right.

Now before you blow a gasket, I'm kidding (partially). It is frustrating when debating evolution/creation because it's like debating politics. You are good to talk to and I do appreciate and learn much more discussing evolution with you because you know much more than me (evolution that is).

I disagree with you on evolution because creation provides better answers. But just because we disagree, doesn't mean we can't have a discussion of the pros and cons of each model.

Sorry about me for being around for a few weeks and then disappear for months. I'm on other forums as well, and I take breaks. I will keep bring up same exact stuff when the answers provided have holes. I do the same with creation as well.
If evolution was in the newspaper, it would be in the funnies
Sun Aug 28, 2016 1:02 pm
RumraketUser avatarPosts: 1170Joined: Fri Jun 25, 2010 7:49 am Gender: Male

Post Re: Challenging Christian Hillbilly on evolution.

Rhed wrote:
Rumraket wrote:
Prove it.


Ok. But first allow me to commend you on your ludicrous ridiculous fast typing skills.
Some of it is copy-pasted, other parts I can write fast becase I remember them well, because I've rexplained them a hundred fucking times before.

Rhed wrote:I have to run, but the post below is the best way of explaining it..

This is a copy/paste from poster forexhr from uncommon descent:

One of the ways to refute Darwin’s theory is to show that evolution can build things by random chance alone and that natural selection has absolutely nothing to do with it, since even the most ardent advocates of evolution admit that organisms complexity is orders of magnitude too improbable to have come about by chance.
And here already we see the first mistake.

You can't "refute" evolution by showing that something was built without natural selection, since the theory includes things like neutral evolution and genetic drift.

Rhed wrote:In order to successfully demonstrate this point we first have to define the meaning of the word “solution” in biology, of course in the context of evolution. Since the DNA is a molecule that carries most of the genetic instructions used in the development and functioning of all known life, the solution in biology is nothing but some arrangement or combination of nucleotides in a DNA. To be more precise, it is the combination of nucleotides that contains the information on how to build some biological structure with the ability to cope with a particular problem at the level of environment, cell or the whole organism.
Seems fine to me.

Rhed wrote:Let us now look at some examples to illustrate this point. Imagine that we have an ecological or environmental area that is inhabited by some organisms. Sources of food in this area are drying up and population of organisms is introduced into a new environment. In this new environment there is a plenty of energy rich substances. But, the problem is that genes for metabolic pathway to convert this substance into usable energy do not exist in a gene pool of that population. Metabolic pathway that can convert this new food into usable energy consists of 2 enzymes. So the information on how to build those enzymes is not present in the DNA, just like information on how to build eyes was not present in the genetic material of the first self-replicating organism. So, here evolution needs to find a solution to this problem which means, evolution needs to find the right combination of nucleotides in the DNA so that cell can produce functional enzymes with the ability to convert new energy rich substance into a usable energy. Once this is done and solution enters the gene pool, natural selection can kick in and spread this new solution through the population. So, this was an example of finding a solution in the context of the environment or by filling of ecological niches.

Yes, fine.

Rhed wrote:For the problem solving at the intracellular level we can use intronic insertions problem. Genes of today’s eukaryotic cells are interrupted by noncoding sequences called introns that need to be removed via splicing machine from the RNA molecule before the process of protein synthesis can begin otherwise they would destroy the protein-coding capacity of genes.

And here is the first problem. The author of this has gone straight to a black and white type of thinking. He imagines introns are huge noncoding insertions that either get fully removed by effective splicing, or that they fully destroy a gene.

It is trivial to see there can be gradations between these two extremes. The insertion could be small enough to reduce the efficiency of the requisite gene, for example, without totally destroying it's function.

Or it could happen in one of several of copies of a gene, the net result of which is an overall reduction in effective gene product at transcription.

In both cases the change would not be lethal, only deleterious. In both cases there are two possible solutions to this:
1. The intron is subjsequently lost to luckly deletion events.
or
2. The intron can be removed again in some way.

The origin of introns is thought to involve self-splicing introns that don't need external protein machinery to assist with splicing. I think you can see where this is going.

Rhed wrote:So, from the evolutionary point of view the splicing machine is the complex evolutionary solution to the intron insertions problem, that began early in a cellular live, once one of these early cells get one of these introns inserted into a critical gene.

Not really. The splicing machine is more like the result of a long process of adaptation to degrading intronic sequences that concomitantly with their genomic proliferation, gradually lost their splicing capability to deleterious mutations.

Rhed wrote:Now that we know what the concept of solution in biology is, we can turn towards the critical point of this demonstration and show why fundamental assumption behind darwin’s theory of evolution is false.
We will do that with the help of one simple analogy in the context of previous intronic insertions example. By using this analogy we will try to solve one problem via evolutionary mechanisms. Ok, let’s start.

Imagine that someone offers to pay you one million U.S. dollars if you can provide the correct answer to the question written down on paper.

I haven't even read this through and I can already anticipate the problem with this terrible analogy. The author of this piece thinks there must, by some extreme event of luck, originate a gigantic spliceosomal complex, or an entirely new protein enzyme, that can splice away new introns, in a single event, or the cell will die because it has introns in critical genes that need to be removed.

As already explained, this is based on a lack of knowledge of the subject. And intron sequences can happen in places where they aren't lethal, just deleterious.

There are self-splicing introns. This means introns were probably already capable of splicing themselves out of the genome when they first started inserting themselves. In this sense, the intron is seen as a kind of genetic parasite that has it's own selective pressure not to kill it's host organism. Introns that fail to splice themselves, or splice weakly or infrequently, lead to lower organismal fitness and are eventually rendered extinct. Or if they happen in critical genes and don't get removed, the carrier organism dies and so cannot pass on a lethal intron.

Introduce a host of well-known population phenomena to this equation and you end up with multiple emerging solutions to the splicing problem, one of which is cooption of various mRNA "chaperone"-like enzymes and RNA-ligases (which already existed, since it is known that some of them act on tRNA or help repair stress-induced RNA damage) to assist in splicing of less efficient self-splicing introns. As the self-splicing introns eventually lose their ability to splice themselves, the duplicated copies of what was initially not absolutely required assisting splicing-enzymes, have now grown more effective and can fully splice out introns that have completely lost the ability to splice themselves, for the simple reason that every mutation that makes a self-splicing intron less able to splice itself, leads to a mutation that increases the efficiency of the assisting splicing protein to be beneficial.

This will eventually go on to become what we see as the modern spliceosomal complex.

As I was typing this out it became apparent to me that, strictly speaking, assistor enzymes are not even required as a product of self-splicing introns gradually degrading and eventually losing their splicing ability. Anything that might assist in speeding up the already happening self-splicing process will be favored, since it will lead to a final translated product quicker. Such cells will be more competitive, since they can upregulate (for example) metabolic enzymes faster in response to changing environmental conditions, and use the foodsource up for producing new cellular copies, before their competitors.

What this means is that assisting splicing enzymes can simply start out as other forms of RNA-processing related enzymes that also happen to have the abilityt to speed up the self-splicing process. A duplicate of such an RNA-processing gene will be free to accumulate mutations such that it becomes more and more effective as a splicer-enzyme instead, while also keeping the original copy to retain the original RNA-processing function.

Rhed wrote:So, you will be rewarded if you provide the right combination of letters, just as the cell in our intron insertions example would be rewarded if evolution provides the right combination of nucleotides in the DNA with the information to make splicing machine. The principle is the same in both problems.

In answering a question you are allowed to use whatever method you want. You can use encyclopedias and textbooks, you can do a Google search, you can conduct science experiments, communicate with other people, and so on. But, you have only one constraint – you are required to use mechanisms of Darwinian evolution. You say, ok, I am fine with that, evolution is a powerful method of finding solutions, as demonstrated in nature and by evolutionary programming so this shouldn’t be a problem.

Finally you ask: so what is this million dollar question? And the person replies: well, you are not allowed to see the question. Remember, you are required to use mechanisms of evolution. And we know that evolution have no intelligence and no mind so evolution can’t see, read, think, percieve,… evolution cannot grasp the problem. The only thing evolution can do in finding solutions is a random shuffling of nucleotides in the DNA and once the solution emerges natural selection process can kick in and spread this solution through the population. In the same way, you are alowed to combine existing letters, words and sentences that exist in books, newspapers, magazines,dictionaries, internet or in your mind. You can do whatever you want in creating new combinations of linguistic elements. The only constraint is your inability to use engineering and inteligent design principles in solving a problem. You are unable to notice or become aware of the question, or in other words, you are unable to create a mental representation of perceived question and then, using your cognitive faculties, to co-opt the right combination of letters, words and sentences according to this mental representation. In short, no intelligence is allowed.

That's an awful lot of words used to say a simple thing like "evolution doesn't have any foresight and only works with mutation and natural selection". Ok, whatever.

Rhed wrote:Now you just thing about the extent of the problem. The subject of the question can be any aspect of the reality that can be expressed in words. So there is a potential for nearly infinite number of potential questions. And since you do not know what the question is you don’t know what words or letters to use, how to combine them, you don’t know what amount of words constitute the correct answer. You just pick letters and words randomly, put them together randomly and hope the correct solution will pop up, so that you can win a million dollars.

Also, in this process you are not able to communicate with the asker about a partial accuracy of the answer since communication is intelligent activity, and we know that evolution does not have intelligence and therefore its not able to communicate.

Bla bla bla. I get it, get to the meat.

Rhed wrote:In our intron insertions problem, solution consists of at least five subprocesses: to recognize mRNA and its intron-exon boundaries, then to cut the RNA, to rearrange cuted parts, to join and finally to release the mRNA molecule. Only when combination of nucleotides in the DNA that contains all five subprocesses exists only then natural selection can act.

Self-splicing introns. Start with them. Gradually evolve the rest on top as described above.

Rhed wrote: And not before. For example: If we assume the existance of splicing helper proteins that assembly at the intron-exon borders to guide small nuclear ribo proteins to form a splicing machine, this partial correctness of the splicing process won’t cause introns to magically disappear without a complete splicing machine.

I agree, which is why I don't start with that. It would also be silly if we could just assume this crap already existed to begin with.

No, the simplest explanation is one that starts with a concrete empirical fact: Self-splicing introns manifestly exist.

And instead of introns happening in critical genes, it happened in non-critical genes. Or in one of multiple duplicates, meaning failure to correctly remove the intron isn't lethal, just deleterious.

This shit is trivial.

Rhed wrote:This partial correctness won’t cause random, blind and unintelligent process to put aside these helper proteins because they’re good for the future splicing function. Evolution has no long term goal, it cannot plan. There is no long distance target to serve as a criterion for selection.

I still agree, which is why I still don't start with that.

I'm gonna skip a lot of the irrelevant talk that follows things built on a flawed premise.

Rhed wrote:Finally, we will unmask the empty rhetoric and logical flaws behind the rationalizations invoked in the “covering up”

yes yes, bla bla bla it's a conspiracy by scientists that hate god. Oh you put the term in quotes, so it's subconscious coverup. Or something.

The person who wrote this is an idiot.

of the fact that evolution proceed by random chance alone. Besides mentioned, natural selection, this rationalizations are usage of terms like “functional shift,” “exaptation,” “co-option”. We will se how absurd they sound when they are put alongside our previous examples. At the end we will see how intelligent design is presuposed in the rationalization called evolutionary algorithms.

Functional shift is an idea in evolutionary biology where some cellular or morphological element adopts a new function. And this is said to be the process by which evolutionary novelty is generated. In the words of our analogy, you are alowed to change one semantically correct word into another, or one syntactically correct sentence into another so that existing words and sentences adopt new semantic or syntactic function or meanings. But, what that has to do with providing the right answer?? Absolutly nothing. The problem is not in creating some new random and functional word or sentence the problem is creating words and sentences which will allow you to win one million dollars. In the same way the problem in biology is not in creating some new random function, problem is in creating function that solves a particular enviormental or intracellular problem, like enzymes with the ability to convert new food into usable energy or molecular machine with the ability to cut introns.

Just as I predicted, this nutter thinks whole swathes of new genes have to originate de novo, in a single generation, or otherwise no solution is possible.

He thinks this because of how little he knows.

Rhed wrote:So the claims like: the acquisition of new functions by molecules involved in developmental pathways is suspected to cause important morphologic novelties…
http://www.ncbi.nlm.nih.gov/pubmed/10376014
…are nothing but empty claims.

What? How did he establish the truth of this assertion? It seems to me he just claimed it with literally zero rational justification.

Sorry, that's not going to fly.

Rhed wrote:They are like saing: the acquisition of new meaning by words involved in writing a novel is suspected to cause important linguistic novelties. So, proponents of evolution completely ignore the question of how evolution finds the solution. Instead, they just appeal to the empty terms and abstract hypothetical scenarios that do not exist in reality.

bla bla bla bla...

It probably sounds awesome to people who agree with him and also know nothing.

Rhed wrote:Second therm, co-option, says that the parts nessecary to create molecular machines could be taken from other molecular machines and combined into the new machine being constructed. In the words of our analogy this is like saing: words nessecary to create the correct answer could be taken from dictionary or some textbook

This analogy is getting more and more absurd. In what way are dictionaries and textbooks analogous to other molecular machines?

Rhed wrote:. As we can see, this is again completely irrelevant since the problem is not in creating the new combination of words. Problem is in creating the correct combination of words in the space of nearly infinite number of possible combinations. But there is also another problem. The co-option argument presupposes that all functional parts already exist.

Well obviously you can only coopt something that already exists.

This idiot seems to think, however, that scientists are saying something was just coopted from something else, without having any clue about whether that something else actually existed at the time. This is not how it works.

Individual proteins are suggested to be coopted from elsewhere if and ONLY if homologus proteins exist outside of the protein in question. Nobody says this protein here for which we have no homologoues elsewhere is just coopted. Nobody. Ever.

I'll skip the rest of the post because it is irrelevant blather just drawn further and further from the same flawed analogy.

Edited for some corrections.
"Nullius in verba" - Take nobody's word for it. https://en.wikipedia.org/wiki/Nullius_in_verba
Extraordinary claims require extraordinary evidence.
Last edited by Rumraket on Mon Aug 29, 2016 1:19 pm, edited 1 time in total.
Sun Aug 28, 2016 4:37 pm
RumraketUser avatarPosts: 1170Joined: Fri Jun 25, 2010 7:49 am Gender: Male

Post Re: Challenging Christian Hillbilly on evolution.

Rhed, if I can give you just one single piece of advice in all of this, it's stop taking Uncommon Descent seriously. They're not honest or rational actors. Whatever you believe, stop taking them as authoritative on any subject.

The people you find over there are the last vestiges of a dead movement to change the american school system. After all the debating, arguing, discussing, the attempts to affect legislation and so on, those few hardcore ID supporters that are the least likely to change their minds are the people who are still around over there. Everyone capable of changing their minds have left. It's been 10 years since the Kitzmiller vs Dover trial, ID has taken a beating in the court and isn't taken seriously anywhere outside of religious institutions.

Think about the most resistant to change atheists you've ever met or had the displeasure of interacting with, think about them taking a beating in the laboratory, in the courts, in philosophy, in basically every intellectual subject, now think about a club for them. The theist version of that club is what you find on Uncommon Descent. You will not find knowledgeable, rational people over there. You will find the few proud souls that just never could let go of their cherised beliefs.
"Nullius in verba" - Take nobody's word for it. https://en.wikipedia.org/wiki/Nullius_in_verba
Extraordinary claims require extraordinary evidence.
Sun Aug 28, 2016 6:39 pm
RumraketUser avatarPosts: 1170Joined: Fri Jun 25, 2010 7:49 am Gender: Male

Post Re: Challenging Christian Hillbilly on evolution.

Rhed wrote:
Rumraket wrote:Didn't you invoke this crap before and get schooled on it back then? Maybe it was someone else. Look around, can't be bothered going through this crap all over again. I really should just start saving my posts and copy-paste responses, you people never learn anything. It's like your brains have reset-switches you hit after every discussion we have. You come, stary around for a spanking for a few weeks, then return months later with the EXACT SAME SHIT all over again.

What the hell is wrong with you?


It wasn't me it was someone else. I know I am getting to you, getting to you. One day though, you will thank me and kiss my butt knowing I was right.

Now before you blow a gasket, I'm kidding (partially). It is frustrating when debating evolution/creation because it's like debating politics. You are good to talk to and I do appreciate and learn much more discussing evolution with you because you know much more than me (evolution that is).

I disagree with you on evolution because creation provides better answers. But just because we disagree, doesn't mean we can't have a discussion of the pros and cons of each model.

Sorry about me for being around for a few weeks and then disappear for months. I'm on other forums as well, and I take breaks. I will keep bring up same exact stuff when the answers provided have holes. I do the same with creation as well.

I understand, I had a long sunday of boredom and it's too easy to vent your frustrations anonymously on the internet.

In my defense, I'm playing wow on a private server and the battleground queues are like 30 minutes of mindless boredom. :lol:
"Nullius in verba" - Take nobody's word for it. https://en.wikipedia.org/wiki/Nullius_in_verba
Extraordinary claims require extraordinary evidence.
Mon Aug 29, 2016 1:25 pm
he_who_is_nobodyBloggerUser avatarPosts: 3318Joined: Tue Feb 24, 2009 1:36 amLocation: Albuquerque, New Mexico Gender: Male

Post Re: Challenging Christian Hillbilly on evolution.

Rhed wrote:
he_who_is_nobody wrote:Rumraket, SpecialFrog, and I answered most of those questions you just posted in this thread back in January. Why ask them again on this forum?


That's because the answers were never experimentally demonstrated; only inferred.


Incorrect. For just one example, here is where I pointed out that your DNA repair kit argument (a favorite of yours) is just an irreducible complexity argument, thus I provided you with a citation of us observing an irreducibly complex system evolving, and here is your shifting the goal posts after that came to light and than you never returning to that thread. That is just one example of us providing observable evidence and not just inferring anything.

Once again, what is the point in asking questions that have been answered for you? Are you just happy to have an argument even when said argument is shown to be false?

Rhed wrote:
Rhed wrote:E5: Horizontal gene transfer - I have it. My father has it. My sister…well, doesn’t have it. But my father's brother's nephew's cousin's former roommate has it. (Parody between Star Wars and Spaceballs)


Rumraket wrote:This makes no sense. Maybe your bad parody ruined it.

HGT has a direct empirical basis. We can literally see that it happens.


The good example would be echolocation in bats and whales.

The echolocation abilities of bats and whales, though different in their details, rely on the same changes to the same gene – Prestin. These changes have produced such similar proteins that if you drew a family tree based on their amino acid sequences, bats and toothed whales would end up in the same tight-knit group, to the exclusion of other bats and whales that don’t use sonar.

This is one of the most dramatic examples yet of ‘convergent evolution’, where different groups of living things have independently evolved similar behaviours or body parts in response to similar evolutionary pressures.

That hurt when you said my parody was bad and it ruined it. :cry:


Inferno wrote:In the exact way Dr. Whittington explained that the amino acids converged in platypus and snakes, meaning the protein sequence, so also do the protein sequences in bats and toothed whales. This is what you get wrong and that's why your example is not valid. Let me make this absolutely clear: When comparing the gene or nucleotide sequence, bats and toothed whales are correctly classified. If the protein sequence is compared, bats are classified with toothed whales. That's the whole deal. The gene sequences are not the same. This is made absolutely clear in a paragraph I quoted earlier:

Convergent sequence evolution between echolocating bats and dolphins (2010) wrote:To test whether convergent changes in bat Prestin genes have also occurred in echolocating whales, we sequenced the entire gene in a range of echolocating toothed whales and non-echolocating baleen whales, as well as additional bats (see Table S1 in the Supplemental Data available on-line with this issue). Trees based on nucleotide alignments from this larger dataset strongly supported the accepted species tree topology, albeit with the clustering of echolocating bats reported earlier [3]. However, in trees based on amino acid sequences, constructed using a range of different phylogenetic methods, we found that the echolocating dolphins now formed a well-supported group with echolocating horseshoe and Old World leaf-nosed bats (node posterior probability = 0.99 or 0.94 depending on the analysis), members of which emit Doppler-sensitive signals dominated by a constant frequency (CF) component [6] ( Figure 1A). Intriguingly, the addition of the sperm whale, which appears to echolocate at much lower frequencies [7], was seen to decrease support for this convergent signal, leading to the cetaceans and bats both forming monophyletic groups. The extent of sequence convergence between bats and whales was thus not sufficient to unite these clades when non-dolphin odontocetes were included in the analysis.


Do you understand your mistake, can we move on?


I just find it weird that Rhed is originally talking about HGTs, yet brings this up, which has little to nothing to do with HGTs. This is an example of convergent evolution.
_BONES AND FOSSILS = LOVE_
(_'--------------------'_)
(_.--------------------._)
Mon Aug 29, 2016 5:16 pm
YIM WWW
PreviousNext
Post new topic Reply to topic  Page 2 of 3
 [ 41 posts ] 
Return to Science & Mathematics

Who is online

Users browsing this forum: Google [Bot] and 6 guests
cron